Terrorism And Its Effects On The United States - 1776 Words

Preventing Terrorism in the United States is a hard thing to overcome, but the government is trying their best to control and prevent terrorist attacks from happening. â€Å"The terrorist attacks on September 11, 2001, were a turning point in American history and demonstrated that the government must have the authority necessary to defend against future attacks, including the right to use the best technology to intercept potentially conspiratorial communications (Jacobs and Newton 1). Having advanced technologies in the United States can prevent Terrorism from happening. Terrorism must be overcome and be eliminated. The government of the United States will do this by having updated, and more advanced security around high populated places such†¦show more content†¦Supporters of the surveillance program argued that wiretaps are a necessary tool for preventing terrorist activity. Some argue that the current process of judicial review and oversight is obsolete given the nature of the terrorist threat, and that the president has been forced to engage in aggressive measures to ensure national security (Jacobs and Newton 2). The first ever used wiretap in the United States was invented before the telephone. Law enforcement started eavesdropping on telegraph communications in the 1860s. Several states made it illegal to â€Å"eavesdrop† on other peoples telegraph communications. Telephones and wiretapping was common in the United States by the 1890s. Some of the media criticized the government for allowing wiretapping without permission. Phon e companies stopped helping authorities with wiretapping because they didn t like how they were using it. Most states banned the wiretapping while other states needed a court approval before they could wiretap telephones. Furthermore, the US Constitution includes no express right to privacy. In order to invoke the right to privacy under the Fourth Amendment, a US citizen must demonstrate a reasonable expectation of privacy. However, the NSA s collection of telephone metadata and monitoring of Internet activity do not interfere with US citizens reasonable expectations of privacy. Because individuals rely on a third party (such as the telephone company or Internet service provider)

Human Genome And A Look Into Schizophrenia Biology Essay Example For Students

Human Genome And A Look Into Schizophrenia Biology Essay Unphased determine whether a familial discrepancy is associated with a disease or trait. If association is present, a peculiar allelomorph, genotype or haplotype of a polymorphism or polymorphism ( s ) will be seen more frequently than expected by opportunity in an single transporting the trait. instance ( Schizophrenia ) and control ( normal ) . frequence of allelomorphs or genotypes is compared between the instances and controls. One job with the case-control design is that genotype and haplotype frequences vary between cultural or geographic populations. We will write a custom essay on Human Genome And A Look Into Schizophrenia Biology specifically for you for only $16.38 $13.9/page Order now After the gel cataphoresis, the PCR merchandises were added with 40I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 2 hours, this is to precipitate out the amplified fragment of DNA. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 minutees. The rinsing procedure was repeated one time more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Milli Q H2O was added to each of the dried sample and heated at 60a„? for 1 minute for blending the H2O and PCR merchandise. Deoxyribonucleic acid Sequencing The stuff used in the Deoxyribonucleic acid sequencing reactions include: primer, either frontward or change by reversal ; 5X Seuqencing buffer ( Applied Biosystems ) ; PCR merchandise ; and Milli Q H2O that to do the entire volume into 15I?l. The Deoxyribonucleic acid sequencing initiated at 95a„? for 5 proceedingss. Each rhythm contains 30 seconds at 95a„? for denaturation, 30s at tempering temperature for each brace of primer for tempering of primer to template DNA, 1 minute at 72a„? for elongation of the merchandise. In the experiment, 30 rhythms were completed for each brace of the primers. Following the reaction rhythms, there was 5 proceedingss at 72a„? as concluding elongation clip. And the reaction merchandises were temporarily stored in the machine at 4a„? as the concluding clasp temperature. 0.72I?l of primer, 3I?l of sequencing buffer, 0.75I?l of Big Dye Terminator version 3.1 ( Applied Biosystems ) , 1.5I?l of PCR merchandise sample and 9.03I?l of Milli Q H2O were made up into reaction mixture. Primer Sequence B22f1S TTAAGCACAGCTACTAGATC B22r2 CAGGGAGGTAGGAATGAGAATCTG B22r2S TTCCCTGGGATTATACATAT B22f3 TCTTTGAGTTATCAGGATTGGG B22f4S ACCATTCTTAATGAATTCCA Table 2: Primers used in sequencing. hypertext transfer protocol: //wpcontent.answers.com/wikipedia/commons/thumb/d/df/DNA_Sequencin_3_labeling_methods.jpg/220px-DNA_Sequencin_3_labeling_methods.jpg Figure 2: Conventional drawing of DNA sequencing. Sequencing Product Purification The sequencing merchandises were added with 48I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 30 proceedingss, this is to precipitate out the Deoxyribonucleic acid fragment. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 proceedingss. The rinsing procedure was repeated twice more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Hi-Deionized formamide was added to each of the dried sample and heated at 95a„? for 3 minute to denature. Consequences Consequences generated by Genepop , By utilizing Hardy-Weinberg equilibrium, we try to prove if the population ( Beijing ) used in the experiment is in equilibrium. Control sample from normal individuals was used to run the Genepop plan. Venue P-value Standard Error W A ; C R A ; H Stairss rs252973 1.0000 0.0000 -0.0395 -0.0398 14657 switches rs10050588 1.0000 0.0000 -0.0055 -0.0056 68379 switches rs171677 1.0000 0.0000 -0.0282 -0.0284 7920 switches rs252975 1.0000 0.0000 -0.0337 -0.0339 10920 switches rs173767 1.0000 0.0000 -0.0440 -0.0442 17820 switches rs153298 0.6843 0.0035 -0.0583 -0.0586 83991 switches rs153299 1.0000 0.0000 -0.0440 -0.0442 18138 switches rs252976 .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49 .postImageUrl , .u0973effd93375e50281bda78684f0b49 .centered-text-area { min-height: 80px; position: relative; } .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49:hover , .u0973effd93375e50281bda78684f0b49:visited , .u0973effd93375e50281bda78684f0b49:active { border:0!important; } .u0973effd93375e50281bda78684f0b49 .clearfix:after { content: ""; display: table; clear: both; } .u0973effd93375e50281bda78684f0b49 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u0973effd93375e50281bda78684f0b49:active , .u0973effd93375e50281bda78684f0b49:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u0973effd93375e50281bda78684f0b49 .centered-text-area { width: 100%; position: relative ; } .u0973effd93375e50281bda78684f0b49 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u0973effd93375e50281bda78684f0b49 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u0973effd93375e50281bda78684f0b49 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u0973effd93375e50281bda78684f0b49:hover .ctaButton { background-color: #34495E!important; } .u0973effd93375e50281bda78684f0b49 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u0973effd93375e50281bda78684f0b49 .u0973effd93375e50281bda78684f0b49-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u0973effd93375e50281bda78684f0b49:after { content: ""; display: block; clear: both; } READ: Gamelan - Music of Indonesia Essay1.0000 0.0000 -0.0444 -0.0447 18232 switches rs1849173 0.8343 0.0016 -0.0430 -0.0432 83419 switches Table 3: Consequences generated from Genepop. Two estimations of Fis: Weir A ; Cockerham s ( 1984 ) estimation ( W A ; C ) , and Robertson A ; Hill s ( 1984 ) estimation ( R A ; H ) . All ( Fisher s method ) : Chi2: 1.1210 ; Df: 18.0000 ; Prob: 1. Under the rule of chance, if the P value is less than 5 per centum, the two Numberss are said to be significantly different, the void hypothesis, in this instance the random brotherhood of gametes, is rejected. From the above tabular array we can see that all SNPs tested have p-value larger than 0.05 ; that is the population at the selected venue is expected to be in equilibrium. As we will compare the differences of SNPs between Schizophrenia patients and normal individuals, the consequences generated by Genepop can except the fluctuation between cultural or geographic populations. The standard mistake of this estimation is much less that 0.01, and the consequences from the appraisal are expected to be dependable. Consequences generated by Haploview Linkage disequilibrium describes a state of affairs in which some combinations of allelomorphs or familial markers occur more or less often in a population than would be expected from a random formation of haplotypes from allelomorphs based on their frequences. Fig3: Haploview show of Schizophrenia patients Fig 4: Haploview show of control group Discussion Sample size

Internet Cafe Ban in manilenos minor Essay Example

Internet Cafe Ban in manilenos minor Essay Background of the Study: School is where students develop skills that help them interpret and adapt to a changing world. This is the place where they are developed and save from vices. Unfortunately, due to the inclusion of technology, students particularly minors, are addicted to the computer games that cause to the cutting classes and worst drop out. Almost everywhere you can see internet Cafe that allow rent computers to anyone. Computer Gaming is one of the main attraction in computer shops that cause addiction to the users or players. This was known as Computer Addiction. Due to the increasing number of minors that are skipping in the class, the government make an action to solved this problem. The Manila City Council passed an ordinance that will prevent the minors in entering to the computer shops with in am to pm, weekdays. The ordinance was created by Executive order no. 14 and City Ordinance no. 8168 on 2007 by Former Manila Mayor Alfred S. Limit. This is intensified the drive against computer shops that allow accessing the students during class hours. This authorizes the parents and teachers to inspect computer shops and internet cafe, if they allow minors inside the shop. We will write a custom essay sample on Internet Cafe Ban in manilenos minor specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Internet Cafe Ban in manilenos minor specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Internet Cafe Ban in manilenos minor specifically for you FOR ONLY $16.38 $13.9/page Hire Writer But only officers of accredited parents and teacher association are assigned to inspect and monitor the shop. They have the authority to take pictures and get the names of the minors, the owner of the shop and the names of the parents. The reports are then goes to the mayor and upon approval of the mayor the license of the shop to operate will be revoked. On the other hand, the identities of the minors are keep safe, for confidential purpose. This ordinance also erred every computer shop to attach No to Pornography and Gambling sign to every computer and that there should be no cubicle or no enclosed separating each computer. There should also be sign on the door stating that Minors and Students are not allowed to enter during Class hours. The implementation of the ordinance aims to give managements of internet shops some rules that will save the youth from computer game addiction that could affect their social well-being, morality and most especially their education. This ordinance is within the Jurisdiction of the City of Manila only. This is a great steps for the decreasing of the number of drop outs and skipping of classes of the minors and student. Here also stated in the ordinance that there is a penalty in breaking the elementary schools are established. This research is conducted for the purpose of identifying the effect of this ordinance in promoting the education of the minor students and to avoid the to the computer addiction that will affect their Studies. For academic purpose the research focus on the locality of selected barraging in Sample manila. V. Theoretical Framework: This study has described a Grounded approach to the design of programs to strengthen hybrid Justice systems that is attuned to local needs and opportunities. Five key steps were proposed: (l)understand the historical and contemporary political and policy context of formal and customary Justice systems; (ii) analyze the strengths and weaknesses of formal and customary legal systems; (iii) identify entry points for strengthening hybrid Justice systems based on an analytical framework of institutional change; (iv) realistically assess the opportunities for engagement on the entry points; and (v) ensure a flexible and long-term commitment to implementation. V. Conceptual Framework: The implementation of the Ordinance no. 168 in Manila City, prohibits the minors in entering in computer shops during school hours. The parents and teacher association are task to inspect the computer shops if they allowing minors to access the computer they own. This is for the promotion of the education of the minors and to save the minors from computer addictions. VI. Paradigm of the Study: VI. Objectives of the Study: MUST: To Identify the effects of the ordina nce no. 168 to the education of the minors. WANTS: To know the purpose of the ordinance. VIII. Statement of the Problems: (General Statement of the Problem): The study focus on the effects of ordinance no. 8168 to the education of the minors in sample manila. (Specific Problems): 1 . What was the characteristics of minors, in terms of: a. Age b. Sex c. Etc. 2. Does the Parents and Teachers Association are educated or knowledgeable to the 4. What are the effects of the implementation of ordinance no. 8168 to the education of the minors? X. Hypothesis: Ha: There is significance between the Ordinance no. 8168 to the education of the minors. Ho: There is no significance between the no. 168 to the education of the minors in Sample Manila. X. Research Design: The Method of research used in this study is Descriptive Method. This Method describes and interprets the present situation and practices in society. Descriptive research Describes and interprets what is. That is concerned with the prevailing practices (Best). In this Research, the intended to be interpreted is the implementati on of the City ordinance 8168. This study will primarily determine the effects of banning the minors in computer shops or internet cafe in the Academic performance of the students of . X. Significance of the Study: The researcher hopes that the result of this study would contribute to the better learning of the minor students. The following are the sectors that affected and gain significant information on this study: 1. To the Minors = this will provide them an information on how important is the Ordinance to their Studies. 2. Parents and teachers association = this is important for hem because it can give them a feedback on how well they are performing the ordinance. 3. To the City Council= For them to evaluate the law, and serve this as their basis in upgrading improving the ordinance. 4. To the Future Researcher: this will serve as their related study in conducting their research. This will also provided information to them on how important is the Ordinance in the academic performance of the Minor students. 5. To the Readers= this will provide them an information to increase their awareness on the ordinances exist in Manila for the welfare of the Minors.

Stanford Acceptance Letter Real and Official

Stanford Acceptance Letter Real and Official SAT / ACT Prep Online Guides and Tips Each year, Stanford Universityreceives over 40,000 applicationsfrom high school hopefuls. Only5% of them get a Stanfordacceptance letter.For example, in 2015, Stanfordaccepted 2,144applicants from a record 42,487applications for the Class of 2019. That’s atiny5.0% admission rate.Unfortunately, the overwhelming majority of applicants get a rejection letter. â€Å"I regretto inform you†¦Ã¢â‚¬ When I was in high school, I was one of the lucky few to apply to Stanfordand receive an acceptance letter in the mail. This validated years of hard work and made me proud that a school like Stanford wanted me as part of their community.Here’s my complete, official Stanfordacceptance letter. Want to learn what it takes to get a Stanfordadmit letter yourself? Read my How to Get Into Harvard and the Ivy League guide. I'll take you through the philosophy behind how to become the world-class student that schools like Stanford, Harvard, and Princeton are looking for. You'll learn what it means to develop an application Spike, why being well-rounded is the path to rejection, and how to craft a compelling application yourself. Read this guide now before it's too late. Here's a scan of the original admissions letter sent to me by the Office of Undergraduate Admission at Stanford University. Even though I decided to attend Harvard, it was a really tough choice to turn down Stanford. It has an energetic, open environment and great location in the Bay Area. In retrospect, with my current interest in entrepreneurship, it might have been really interestingto attend Stanford. Afterward, I'll give you tips on what it takes for you to get an acceptance letter like this for yourself. Stanford University March 2005 Dear Allen, Congratulations! It is with great pleasure that I offer you admission to the Stanford University Class of 2009. Your thoughtful application and remarkable accomplishments convinced us that you have the intellectual energy, imagination and talent to flourish at Stanford. Among the over 20,000 applications we read, your distinguished record of academic excellence and personal achievement stood out. We are thrilled to welcome you to the Stanford community and look forward to the unique and extraordinary contributions we know you will make to the intellectual and extracurricular life of our campus. The exciting next step is now yours. As Stanford is probably only one of several options you will consider in the coming weeks, I hope you will use the time to learn more about us. We invite you to participate in Admit Weekend 2005, a three-day program that will introduce you to the intellectual vibrancy and dynamic campus life that define Stanford. Information about that event is enclosed. Whatever decision you make, we ask that you complete the enclosed enrollment response card and return it to us by the postmark deadline of May 2, 2005. Should you decide to matriculate at Stanford - and we sincerely hope you do - we will send enrollment information to you in late May. While we have every reason to believe you will complete this school year successfully, remember that your admission is contingent upon your continued strong academic performance in the program you presented to us in your application. Once again, I extend my congratulations on your admission to Stanford and welcome you to the Stanford family. Sincerely, Anna Marie Porras Director of Admission (Bring your light saber to Stanford!) The lightsaber comment is a reference to my Stanford supplemental essay. Want to build the best possible college application? We can help. PrepScholar Admissions is the world's best admissions consulting service. We combine world-class admissions counselors with our data-driven, proprietary admissions strategies. We've overseen thousands of students get into their top choice schools, from state colleges to the Ivy League. We know what kinds of students colleges want to admit. We want to get you admitted to your dream schools. Learn more about PrepScholar Admissions to maximize your chance of getting in. OK....so now what? You probably have a reason forlooking at this acceptance letter. Let me try to help you out. If you just received a rejection letter from Stanford, I'm sorry. When admissions officers say deciding between students is really tough, they're speaking the truth. The good news is that you're in command of your future. There are Stanfordgraduates who end up lostin life, and there are graduates from hundreds of other colleges (and even people who never went tocollege) who end up with amazing achievements. You're in control of your own fate. So if you're disappointed about a Stanfordrejection, I hope you pick yourself up and excel from this point forward. Here's a guide on how to get great grades in collegeand prepare yourself for the future. If you're planning your college application and want to apply to Stanford, I hope this acceptance letter inspires you to want your own. Make no mistake, it took a lot of hard work to get to the point where I felt I was likely to pass Stanford's tough admission requirements. Throughout high school, I had to strategize carefully and spend my time effectively so I could balance great grades,AP coursework,hightest scores, and deep extracurricular activities. To help you out,I've written everything I know about succeeding in high school and college admissions. If you want your own Stanford acceptance letter, these are must-read guides: 1) How to Get Into Harvard, Stanford and the Ivy League This is the most fundamental guide to help you understand what top colleges like the Ivy Leagues are looking for. Here you'll learn: what kinds of students are most attractive to Stanfordand why why being well-rounded is the path to failurein selectivecollege admissions what a Spike is and why an effective Spike will get you admitted to every college how you can develop your own compelling Spike I'm not saying it's easy, because it's not at all trivial. But in my experience with many thousands of students across the country, far too many have the wrong idea about what colleges actually want. In the process, most studentswaste far too much time on things that aren't important and do nothing to raise their admissions chances. Even worse, they end up miserable and stressed all day. That's why I wrote this guide. Read it before it's too late - it mighttotally change your high school strategy. 2) My Complete Successful Application, including Common App and Supplement To complement my "How to Get Into Stanford" guide, I share my entire college application, page by page, word for word. You'll see the exact application that the admissions committee at Stanfordsaw, including the Common Application, my personal essays, letters of recommendation, and transcript. I also provide commentary on every piece of my application. You'll see what was REALLY important to get me into Stanford,and other things that weren't. You'll even see mistakes I made in my application. I've never seen anyone else provide this level of analysis and detail,so I believeyou'll get something out of it. 3) How to Get a 4.0 GPA and Better Grades Your coursework is a critical componentof your college application. Not only do you need great grades, you need great grades in whatStanford says is "among the most demanding courses available at your school." Thus it's no surprise that a lot of high school students are stressed out and anxious. Do you ever feel like you're taking too many AP courses and struggling to balance everything? The biggest problems I see in the students I work with are in mindset, habits, and strategy. To help students out, I've written a complete guide onhow to excel in high school coursework. I take you through three levels of detail, from high to low: Mindset and Psychology: Do you have the confidence to know you can even improve? Are you prepared to work hard? Overall Planning and Habits: Do you make the most out of every hour? Do you understand what teachers care about, and how to give them what they want? Do you know how to avoid procrastination? Individual Class Strategies: How do you excel in English classes? How is this different from math and science classes? I learned a lot of these lessons the hard way, throughout high school and college. This is the guide I wish I had before starting high school. Take the time to read it and you might get better grades while saving hundreds of hours of study time. 4) How to Get a Perfect SAT Score/ How to Get a Perfect ACT Score As you already know, besides GPA, theother major number on your application isyour SAT/ACT score. This score isso important because it compares you to high school students across the country on even ground. Top schools like Stanfordexpect you to be in the top 1 percentile of the country. If you're not, you'll cast serious doubt on your academic ability and your ability to thrive at Stanford. In my perfect SAT and perfect ACT guides, I share the major strategies that you'll need to boost your score above a 2100 on the SAT and 32 on the ACT. Also, check out my series on getting perfect scores in each of the sections on the SAT/ACT: SAT 800 Series: Reading | Math | Writing- Learn important strategies to excel in each section of the SAT. ACT 36 Series: English | Math | Reading | Science - Learn how to get a perfect 36 on each section of the ACT. Want to improve your SAT score by 160 points or your ACT score by 4 points?We've written a guide for each test about the top 5 strategies you must be using to have a shot at improving your score. Download it for free now:

Black Boy Essay Research Paper Black BoyWhen

Black Boy Essay, Research Paper Black Boy When a individual thinks about hungriness, nutrient comes to mind. We neer think of hungriness as anything else. In Richard Wright # 8217 ; s book Blackboy, a immature male child faces many different types of hungriness. He refers to the phrase # 8220 ; American Hunger # 8221 ; throughout his book. I feel that the # 8220 ; American Hunger # 8221 ; which he is mentioning to is the hungriness to be considered an American and be treated as an equal. Throughout his life he was treated as if he were from another planet. He was ever considered to be different, an castaway and a also-ran. He felt the demand to be a portion of the alleged American Culture. He wanted to be able to make what the white kids did. He wanted to be able to travel to school, to larn, to read, hold friends, have a occupation ; but because he was an African American he could non. This is what I will be discoursing, his hungriness. Hunger is non the merely hungriness he felt. He felt many other types of hungriness throughout his life. His hungriness came about when his male parent left his household hungering which led to Richards physical hungriness. He feels as though it is his occupation to back up and assist his household since his pa left. By reading and larning through colleagues he learned how to cover with others, whether they are black or white. He learns the secret of how to last in his society by watching how others act and react to one another. An illustration of this is when Richard is in the lift and the black get says # 8220 ; Watch this. I will acquire a one-fourth # 8230 ; # 8221 ; So the child lets a white adult male kick him in the buttocks every bit hard as he can merely for a one-fourth. This secret is what keeps him alive, places him in society where he belongs, and lets him populate out is dream of going a author. Richard was so eager to larn that he kept invariably inquiring inquiries, and if his inquiries were left unreciprocated he would allow his imaginativeness take over.. He would seek to happen work in which he would be able to read some of the B ooks. His household and relations refused to allow him larn. There is one incident in which his school teacher read to him. His grandma got angry and said that reading was devils work. Through out his childhood he heard many footings and phrases. He neer understood what they meant but one time they were said he knew if they were good or bad. For illustration, when Richard was taking a bath and his grandma came in to scour his rear, Richard replied with, â€Å"When you get through, snog back there.† This is merely one of the many phrases he said in which he did non cognize the significance. Richard’s grandma flipped and wanted to crush Richard for what he had said. Richard had learned that phrase from school and didn’t know the significance. Through his avidity to larn he began to understand himself, other inkinesss, and Whites better. He continues to larn and to play dumb for his ain endurance. His self instruction began when a colleague Lent Richard his library card to read Mencken # 8217 ; s essays. He eventually got a interruption from a white adult male who trusts Richard and is willing to allow him read what he wants to read. He lets Richard # 8220 ; feed his hungriness, # 8221 ; He feels that his dreams and his narratives in which he reads are an flight for him. He wants to suit in with others and be able to be apart of America. He feels the demand to travel to school because it is his aspiration to go a author. His reading puzzled his Aunt Maggie for she could non understand why person would be reading merely for merriment because they liked it. Through out the book Richard tries to feed all his hungriness so that he isn # 8217 ; t hungry any longer. Not in the sense of nutrient but the sense of cognition. Back so it was difficult to be the colour black and survive and learn. Race was a large thing and could hold gotten him killed at any clip. But Richard learned organize his errors and other peoples errors and overcame many obstructions. He is a nationalist a hero a MAN. I feel that Richard had # 8220 ; kept himself full! # 8221 ;

Customer Service Software and how it provides tools used in enhancing Essay

Customer Service Software and how it provides tools used in enhancing customer service - Essay Example An excellent customer service ensures that the customers know the services expected from the organization, and the organization should ensure high quality information about the regular customer needs. The company management should be easily accessible, and response should be fast. Customer service provides a framework in the creation of commendable customer relationship within the organization. Customer service creates trust and loyalty between the organization and the customers transcending moment interaction. Mostly, complaining psychology ensues as measurement for crises ad opportunities (Kelshall 2009, p.223). Customer service entails all the activities that enhance high level customer satisfaction by ensuring the services and the product meet the customer expectation, and it enhances income and revenue generation. Customers and the Organization Customers can be regarded as key stakeholders to every success within an organization. The constant drive in customer satisfaction is th e duty of all people within an organization. The appreciation of the employees in organizations takes place regardless of whether the link is direct or indirect. Many organizations consider the customer role as the prime. This happens through corporate training programs and improved communication techniques. Customer satisfaction by an organization requires maintenance of the customer contacts. Marketers enhance customer satisfaction through market survey and research to offer insights on the new services and products sought by the customers (Rao & Madhavi 2004, p. 38). Customers influence the decision by the marketing team towards decision making. Customers are crucial determinants of profits and revenues and ensure job security within an organization. Therefore, viability of an organization measured based on the potential of an organization to attract customers. Provision of excellent customer service is the paramount goal of an organization (Chung 2006, p. 10). Customer satisfact ion and the client retention Customer retention ensures continued business relationship between the customer and the firm. On the other hand, customer satisfaction is the measure of the surpassing power of goods and services by an organization to customer expectation. Commendable customer satisfaction accompanies loyalty. The organization with high customer satisfaction pays little attention to the advertising from their competitors. Satisfaction influences repurchasing intention and ensures customer retention. Unsatisfied customers may continue their patronage based on fear of shifting to other alternatives. Fear is created by the unawareness of the other services elsewhere, especially when using the repurchase intention in measuring the customer satisfaction (Kelshall 2009, p.224). Relationship between organization profitability and customer satisfaction Many studies indicate the correlation between the customer satisfaction and the organization profitability. Happy employees comm unicate well with the customers. The customers continue with their patronage. The relationship develops leading to continuous loyalty. Invariably, the defection rate reduces and acquisition of new customers results. Good customer service is critical in enhancing customer perceived value. The overall assessment of the customer on the product utility improves the customer loyalty. The customer perceived values influence the cost and the tastes of the customers. The interaction efficiency with the staff influences the perceived value

Respond Movie Review Example | Topics and Well Written Essays - 250 words - 1

Respond - Movie Review Example After a long duration of attempting to provide answers to his questions, Tim formulated a thesis and his work brought to a halt the raising of more question and judgments. He concluded his research process convinced that Vermeer used optical devices to undertake his work in painting. Tim ultimately answered the numerous questions that he posed and that his critics could have raised. Through setting on a course to establish the techniques that a predecessor artist used in his work, one can say that Tim engages in a process of critical inquiry. To guide the endeavor, he had to pose critical questions that he was to provide their answers based on his research. However, Tim was successful in narrowing down the differences that existed in his initial views and Vermeer’s perception and techniques or tools of art. Through successfully answering his critical questions, he minimizes the broader discourse that would have existed between his perception and Vermeer’s views on the techniques and tools of art. Therefore, Tim harmonizes his views with his predecessor through confirming the validity of his thesis. Tim’s rhetorical situation is that he seems to become obsessed with work that was originally done by another artist. His situation leaves one wondering whether he lacks originality or whether he just needs to prove a point. The fact that he confi rms the techniques used in Vermeer’s work was not any different from what he thought is a sign that there is no discovery that he