Drug Development Of The Drug Imatinib - 1050 Words

TRM6002 Essay 2 – Drug Development State what the target for the drug imatinib is, and why that target was a good choice for a drug discovery project. Summary/Abstract: Until the 1990’s, drug discovery relied on forward pharmacology where trial and error produced medications that were usually involved in changing DNA synthesis and/or cell division. These medications were efficacious, but had issues with systemic toxicities due to their non-selectivity of diseased cells or disease causing proteins. With the discovery of specific genetic changes that occur in Chronic Myeloid Leukemia, a haematological malignancy, a target was identified which was only seen in diseased cells; thus, rational drug design came about. Imatinib is the first medication of rational drug design with action only in diseased cells. Introduction: Historically, drug discovery projects were aimed at developing drugs that were involved in changing DNA synthesis and/or cell division. These medications included alkylating agents which were very effective but due to the large range of non targeted action within the body, had multiple side effects and toxicities. Since the discovery of specific and varied genetic changes that can occur within cancerous cells, the approach to drug development has changed significantly. Imatinib was one of the first drugs developed where its site of action was only on diseased but not on non-diseased cells. Discussion: Drug discovery programs start when there is aShow MoreRelatedChronic Myeloid Leukemia1139 Words   |  5 PagesRegarding our recent inquiry as to the viability of an Abl-Bcr inhibitor and the marketability thereof, it is of prudent management to discern the separation between our drug candidate and those drugs currently existing in the market, and evaluating the ease of development as well as long-term payoffs of said inhibitor. First, however, an introduction to chronic myeloid leukemia, its symptoms and diagnoses, as well as current treatments, is in order. In better understanding the disease, we can moreRead MoreOrphan Drug Report627 Words   |  3 PagesOrphan Drug Report An orphan drug is a drug designed to treat a rare disease or condition. For a drug to qualify for orphan status both the drug and disease or condition must meet certain criteria specified in the Orphan Drug Act (ODA). This designation would qualify the sponsor of the drug for developmental incentives which includes waiving of regulator fees, faster or simpler clinical trial and approval process, tax credit or grants to offset research and development, and a period of marketingRead MoreAnilinoquinazoline Mechans Of Egfr918 Words   |  4 Pagessignificantly with increased angiogenesis with poor prognosis in NSCLC (Shikada et al., 2005; Kojima et al., 2005). Initial studies show that the combination of bevacizumab and chemotherapy increase the overall survival of advanced colorectal cancer. The drug development strategies added small molecule tyrosine kinase inhibitors for the antiangiogenesis. One preclinical study identified that the combination of bevacizumab and the anti-EGFR TKI Erlotinib are inhibit the receptor like VEGFR and EGFR pathways inRead MorePrice Matter At Customers : Drugs And Treatment For Chronic Myelogenous Leukemia ( Cml )845 Words   |  4 Pagesaffordability of their treatments. For some of the newest treatments on the market, drug prices, and subsequently patient costs, have reached unsustainably high levels. There is no denying that drug development has improved the lives of patients. â€Å"Rational drug design†, the process of developing medications based on the identification of a specific biological target, has produced promising new medications. For instance, Gleevec (imatinib) is a treatment for Chronic Myelogenous Leukemia (CML). In contrast toRead MoreEssay On Sunitinib1480 Words   |  6 Pagesstable disease for at least 12 weeks in 17 % of DTC and 38 % in MTC patients [18]. Imatinib is a TKI that garnered much attention for its highly favorable effect on chronic myeloid leukemia and has inhibitory action against PDGFR-a and PDGFR-b, c-KIT and RET. It has been shown to reduce RET-mediated cell growth of MTC cells [19]. It was investigated in two trials: phase I in which MTC patients treated with imatinib combined with dacarbazine and capecitabine did not report objective responses and phaseRead MoreAdvances in the Pharmaceutical Industry571 Words   |  2 Pagesadvances in the pharmaceutical industry increase as well. While most companies use the mentality of screening drugs that show the most binding affinity or particularity of drug applicants to a single defined target, this is not always the best way of doing things. Many off target activities or multi-targeted particularities have been successful in targeted therapeutics. For example, Imatinib marketed by Novartis and Sorafenib co-developed and co-marketed by Bayer and Onyx Pharmaceuticals and NexavarRead MoreThe Impact Of Traditional Chemotherapeutic Agents On Patients2189 Words   |  9 PagesIn contrast to a decade ago, we’ve seen an explosion of new drugs and virtually all of these drugs are targeted therapies. The substantial increase in the transition of FDA approvals from standard chemotherapeutics to targeted therapies is also equally astounding (Martino et al., 2015). The traditional chemotherapeutic agents are simply not being developed with the same frequency by drug companies any more. While chemotherapeutics have had a real impact and in some diseases a dramatic impact, forRead MoreWhat Would I Do If My Friend Had Leukemia?2592 Words   |  11 Pageskinase. Drugs known as tyrosine kinase inhibitors (TKIs) that target BCR-ABL are the standard treatment for CML. These drugs include Imatinib, Dasatinib, Nilotinib, Bosutinib, and Ponatinib. All of these drugs can have serious or even deadly interactions with other drugs, over the counter supplements, and even certain foods (such as grapefruit and pomegranates). The most common method used for treating Chronic Myeloid Leukemia was Interferon-Alpha. This substance reduces growth and development of leukemiaRead MoreChronic Myeloid Leukemia ( Leukemia )1270 Words   |  6 Pagesmany without these risk factors have will develop leukemia. Treatments can include chemotherapy, to kill the mutated cells in the body, radiation therapy, where high beams of energy are used to stop the further growth of malignant cells, and certain drugs that can target specific weaknesses in the cells again slowing and stopping further growth and proliferation. All of these therapies are dependent on the patient, his or her health, the severity of the disease and type of leukemia. Stem cell therapyRead MoreChronic Myelocytic ( Or Myelogenous ) Leukemia ( Cml )1290 Words   |  6 Pagesin DNA that turn on oncogenes (genes that promote cell growth and division) or turn off tumor suppressor cells (genes that slow down cell division or encourage apoptosis). CML is due to the formation of a new oncogene. The process involves the development of abnormal chromosomes, the abnormal chromosome creating a new fusion-gene, and the fusion-gene creating a protein that triggers cell division of diseased blood cells (Mayo Clinic, Hehlmann et al. 2007). During mitotic cell division in the myeloid

Terrorism And Its Effects On The United States - 1776 Words

Preventing Terrorism in the United States is a hard thing to overcome, but the government is trying their best to control and prevent terrorist attacks from happening. â€Å"The terrorist attacks on September 11, 2001, were a turning point in American history and demonstrated that the government must have the authority necessary to defend against future attacks, including the right to use the best technology to intercept potentially conspiratorial communications (Jacobs and Newton 1). Having advanced technologies in the United States can prevent Terrorism from happening. Terrorism must be overcome and be eliminated. The government of the United States will do this by having updated, and more advanced security around high populated places such†¦show more content†¦Supporters of the surveillance program argued that wiretaps are a necessary tool for preventing terrorist activity. Some argue that the current process of judicial review and oversight is obsolete given the nature of the terrorist threat, and that the president has been forced to engage in aggressive measures to ensure national security (Jacobs and Newton 2). The first ever used wiretap in the United States was invented before the telephone. Law enforcement started eavesdropping on telegraph communications in the 1860s. Several states made it illegal to â€Å"eavesdrop† on other peoples telegraph communications. Telephones and wiretapping was common in the United States by the 1890s. Some of the media criticized the government for allowing wiretapping without permission. Phon e companies stopped helping authorities with wiretapping because they didn t like how they were using it. Most states banned the wiretapping while other states needed a court approval before they could wiretap telephones. Furthermore, the US Constitution includes no express right to privacy. In order to invoke the right to privacy under the Fourth Amendment, a US citizen must demonstrate a reasonable expectation of privacy. However, the NSA s collection of telephone metadata and monitoring of Internet activity do not interfere with US citizens reasonable expectations of privacy. Because individuals rely on a third party (such as the telephone company or Internet service provider)

Human Genome And A Look Into Schizophrenia Biology Essay Example For Students

Human Genome And A Look Into Schizophrenia Biology Essay Unphased determine whether a familial discrepancy is associated with a disease or trait. If association is present, a peculiar allelomorph, genotype or haplotype of a polymorphism or polymorphism ( s ) will be seen more frequently than expected by opportunity in an single transporting the trait. instance ( Schizophrenia ) and control ( normal ) . frequence of allelomorphs or genotypes is compared between the instances and controls. One job with the case-control design is that genotype and haplotype frequences vary between cultural or geographic populations. We will write a custom essay on Human Genome And A Look Into Schizophrenia Biology specifically for you for only $16.38 $13.9/page Order now After the gel cataphoresis, the PCR merchandises were added with 40I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 2 hours, this is to precipitate out the amplified fragment of DNA. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 minutees. The rinsing procedure was repeated one time more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Milli Q H2O was added to each of the dried sample and heated at 60a„? for 1 minute for blending the H2O and PCR merchandise. Deoxyribonucleic acid Sequencing The stuff used in the Deoxyribonucleic acid sequencing reactions include: primer, either frontward or change by reversal ; 5X Seuqencing buffer ( Applied Biosystems ) ; PCR merchandise ; and Milli Q H2O that to do the entire volume into 15I?l. The Deoxyribonucleic acid sequencing initiated at 95a„? for 5 proceedingss. Each rhythm contains 30 seconds at 95a„? for denaturation, 30s at tempering temperature for each brace of primer for tempering of primer to template DNA, 1 minute at 72a„? for elongation of the merchandise. In the experiment, 30 rhythms were completed for each brace of the primers. Following the reaction rhythms, there was 5 proceedingss at 72a„? as concluding elongation clip. And the reaction merchandises were temporarily stored in the machine at 4a„? as the concluding clasp temperature. 0.72I?l of primer, 3I?l of sequencing buffer, 0.75I?l of Big Dye Terminator version 3.1 ( Applied Biosystems ) , 1.5I?l of PCR merchandise sample and 9.03I?l of Milli Q H2O were made up into reaction mixture. Primer Sequence B22f1S TTAAGCACAGCTACTAGATC B22r2 CAGGGAGGTAGGAATGAGAATCTG B22r2S TTCCCTGGGATTATACATAT B22f3 TCTTTGAGTTATCAGGATTGGG B22f4S ACCATTCTTAATGAATTCCA Table 2: Primers used in sequencing. hypertext transfer protocol: //wpcontent.answers.com/wikipedia/commons/thumb/d/df/DNA_Sequencin_3_labeling_methods.jpg/220px-DNA_Sequencin_3_labeling_methods.jpg Figure 2: Conventional drawing of DNA sequencing. Sequencing Product Purification The sequencing merchandises were added with 48I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 30 proceedingss, this is to precipitate out the Deoxyribonucleic acid fragment. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 proceedingss. The rinsing procedure was repeated twice more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Hi-Deionized formamide was added to each of the dried sample and heated at 95a„? for 3 minute to denature. Consequences Consequences generated by Genepop , By utilizing Hardy-Weinberg equilibrium, we try to prove if the population ( Beijing ) used in the experiment is in equilibrium. Control sample from normal individuals was used to run the Genepop plan. Venue P-value Standard Error W A ; C R A ; H Stairss rs252973 1.0000 0.0000 -0.0395 -0.0398 14657 switches rs10050588 1.0000 0.0000 -0.0055 -0.0056 68379 switches rs171677 1.0000 0.0000 -0.0282 -0.0284 7920 switches rs252975 1.0000 0.0000 -0.0337 -0.0339 10920 switches rs173767 1.0000 0.0000 -0.0440 -0.0442 17820 switches rs153298 0.6843 0.0035 -0.0583 -0.0586 83991 switches rs153299 1.0000 0.0000 -0.0440 -0.0442 18138 switches rs252976 .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49 .postImageUrl , .u0973effd93375e50281bda78684f0b49 .centered-text-area { min-height: 80px; position: relative; } .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49:hover , .u0973effd93375e50281bda78684f0b49:visited , .u0973effd93375e50281bda78684f0b49:active { border:0!important; } .u0973effd93375e50281bda78684f0b49 .clearfix:after { content: ""; display: table; clear: both; } .u0973effd93375e50281bda78684f0b49 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u0973effd93375e50281bda78684f0b49:active , .u0973effd93375e50281bda78684f0b49:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u0973effd93375e50281bda78684f0b49 .centered-text-area { width: 100%; position: relative ; } .u0973effd93375e50281bda78684f0b49 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u0973effd93375e50281bda78684f0b49 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u0973effd93375e50281bda78684f0b49 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u0973effd93375e50281bda78684f0b49:hover .ctaButton { background-color: #34495E!important; } .u0973effd93375e50281bda78684f0b49 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u0973effd93375e50281bda78684f0b49 .u0973effd93375e50281bda78684f0b49-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u0973effd93375e50281bda78684f0b49:after { content: ""; display: block; clear: both; } READ: Gamelan - Music of Indonesia Essay1.0000 0.0000 -0.0444 -0.0447 18232 switches rs1849173 0.8343 0.0016 -0.0430 -0.0432 83419 switches Table 3: Consequences generated from Genepop. Two estimations of Fis: Weir A ; Cockerham s ( 1984 ) estimation ( W A ; C ) , and Robertson A ; Hill s ( 1984 ) estimation ( R A ; H ) . All ( Fisher s method ) : Chi2: 1.1210 ; Df: 18.0000 ; Prob: 1. Under the rule of chance, if the P value is less than 5 per centum, the two Numberss are said to be significantly different, the void hypothesis, in this instance the random brotherhood of gametes, is rejected. From the above tabular array we can see that all SNPs tested have p-value larger than 0.05 ; that is the population at the selected venue is expected to be in equilibrium. As we will compare the differences of SNPs between Schizophrenia patients and normal individuals, the consequences generated by Genepop can except the fluctuation between cultural or geographic populations. The standard mistake of this estimation is much less that 0.01, and the consequences from the appraisal are expected to be dependable. Consequences generated by Haploview Linkage disequilibrium describes a state of affairs in which some combinations of allelomorphs or familial markers occur more or less often in a population than would be expected from a random formation of haplotypes from allelomorphs based on their frequences. Fig3: Haploview show of Schizophrenia patients Fig 4: Haploview show of control group Discussion Sample size