Sunday, August 23, 2020
Spear Fishing Essay Research Paper Cause or free essay sample
Lance Fishing Essay, Research Paper Cause or Consequence Lance Fishing Free honkytonk spear angling is a truly satisfying games. This incredible out-of-entryway sports is an ideal way to keep up the natural structure extremely sound. It can result the natural structure from multiple points of view. It functions as an incredible cardiovascular practicing ; an extraordinary way to reduce accentuation ; and an awesome way to get the correct nourishments the natural structure needs to stay solid. The principal result that free honkytonk spear angling has on the natural structure is the way it permits the natural structure to stay in structure with its requesting cardiovascular work out. Lance angling requires the angler to travel and run for the fish. To make this the angler must come in the H2O and swim to where the fish are generally rich. The swimming procedure utilized for skewer angling is an altered free way swim. The authorities and weaponries are non utilized for swimming, there essential point is to keep the lance firearm or Hawaiian sling. We will compose a custom article test on Lance Fishing Essay Research Paper Cause or or on the other hand any comparative theme explicitly for you Don't WasteYour Time Recruit WRITER Just 13.90/page The legs power the move during the swim. Swimming is a known practicing that improves the chest, lungs and musculuss. The chest gets an incredible exercise. As the chest rate goes up the chest siphons more blood to the natural structure leting more O to cause the phones to bring forthing more advantageous cell tissue. The lungs other than get an incredible exercise. As the angler swims, the lungs are being utilized to there fullest. Substantial outside breath and terminating makes the natural structure infer more air current, which assembles perseverance and backbone. This method of using the chest and lungs improves the full circulatory framework. The musculuss other than increase a cluster through swimming. The natural structure is using a bunch of musculuss during the swim. The musculuss are constantly being utilized leting them to go tone. Swimming is known to start up to 300 Calories a hr. The second outcome that lance angling can hang on the natural structure is that it is an incredible accentuation substitute. Lance angling can be an extremely lovely release uping sports. The lowered universe is an extremely wonderful imaginative movement. The sea has numerous things to see and research. During a chasing experience an angler may meet a wide range of kinds of fish or stones. Sing such delightful things that are non ordinarily seen on a standard balance can be truly respecting. Bing abl nutrient E to see an uncommon vivid tropical fish or a lovely brilliant orange coral reef can pass on a gigantic total of invigoration and felicity to the angler. The venture of chasing and getting fish gives the natural structure an adrenalin scurry and a feeling of accomplishment. The incredible emotions the natural structure brushs while stick calculating gives the natural structure a start of unwinding. It permits the head to cover pretty much all the frightening things throughout everyday life and dressed metal on the more delightful things. The third outcome that lance angling can hang on the natural structure is the way the fish that are gotten give the natural structure the correct nourishments it needs to stay solid. A fish falls under the meat bunch in the fundamental nourishment rules. It contains an incredible total of nourishments the natural structure requires. Fish are an extraordinary start of protein. Protein is one of the greater part of import components utilized by the natural structure to keep up great wellbeing and verve. All the tissue, castanetss, and nervousnesss are comprised of to a great extent protein. It contains a significant start of building stuff for the musculuss, blood, covering, hair, nails, and interior assortment meats. Without protein the natural structure would go extremely sick and feeble. Fish other than contain numerous different nutrients and minerals. Take pink salmon for flicker of an eyes. It contains non only the very required protein it contains nutrient A, nutrient B1, nutrie nt B2, nicotinic corrosive and Ca. These nourishments are other than required by the natural structure to remain solid. Fish contain little to no fat which implies that eating fish is an extremely solid way to eat up the best possible entireties of nourishment the natural structure needs. The natural structure is an extremely of import part in a man? s life. It can result the individual from multiple points of view. In the event that the natural structure is powerless and sick so the individual likely won? T be too much cordial and enthusiastic. Yet, on the off chance that the natural structure is solid and sound with the goal that individual will be bound to populate a bold and fiery life. Keeping a fit of rage and sound natural structure isn? t hard to make. There are numerous approaches to achieve this end. By eating the correct supplements and applying on a standard balance the natural structure can remain in great wellbeing. Lance angling is a gutsy way to secure a cardiovascular work out ; reduce accentuation ; and have an extremely solid dish to eat. 321
Friday, August 21, 2020
Explain the nature and purpose of the ‘Hitler Youth’ movement
a) To set up a steady future for the Nazi system, Hitler was resolved to oversee the up and coming age that was Germany's childhood, to do this he made a few gatherings for the two young men and young ladies to train them Nazi belief system and how to be the ‘superior race'. Hitler's childhood development was made obligatory to participate in 1936 and from that point on young men at the age of 6-10 wore enrolled to the ‘Pimpf', which deciphers as meager colleagues, here they partook in activities, for example, climbing and outdoors. On outperforming the age of 10 they experienced a test from them to reach ‘Deutsche Jungvolk' (or German youngsters). Simply after this wore they joined up with ‘Hitler youth' when they wore between the ages of 14-18 and there they wore prepared on military order. The Hitler youth was additionally utilized as a way showing youngsters in against Semitism, pride for Germany and loyalty to Hitler. Small kids were relied upon to peruse books portraying how Jewish things and individuals were malevolent. There was additionally the SRD which was a watch administration that would watch that all the individuals from the Hitler Youth were looking keen and that they were conveying a spotless hanky and brush, which char acterizes the significance of the development. Baldur Von Schirach drove the Hitler youth association and he had the plan to make singular years for the Hitler youth development and in 1934 it was the ‘Year of Training' where the children learned professional preparing, and in October were sent to the nation to collect the yields. This was obviously to show them the estimation of hard physical work, and how it pays off. The following year was ‘The Year of Physical Training' which comprised of thorough game rivalries and fighter like wellness gauges. Hitler felt that his childhood ought to have to a greater degree a solid character and look more truly sound as opposed to be knowledgeable in the homeroom. Hitler needed his childhood to feel that they are better than others are and be glad to be Germans. When in the homeroom the educators showed their educational program to underscore Nazi topics and history. The motivation behind these male gatherings was that Hitler was preparing every single kid in Germany to become officers; the regalia that they wore were like that of the SS, a world class some portion of the military. The Hitler youth was actually an instructional hub for future individuals from the SA or the SS. My hypothesis on Hitler's ‘Deutsche Jungvolk' was that youngsters were conditioned with Nazi philosophy and military strategies and concerns. Hitler had unlimited oversight over each and every phase in the youthful German kid's lives. Young ladies were additionally compelled to join up with a gathering which was known as ‘Jungmadel' (youthful ladies) at 10 years old to 14 and Girls from fourteen to eighteen were in the ‘Bund Deutcher Madel' (BDM) (League of German Girls), the BDM likewise offered a wide assortment of different exercises, for example, diminished rates at cinemas, going on field trips, and go to camps that kept going somewhere in the range of one day to a little while. BDM bunches got together 2 times each week, one of which was a games evening, the other of which was called ‘Heimatabend' (home night). During the home night, young ladies played music, learned and sang people tunes, messed around, or did expressions and artworks. The BDM set enormous significance on the young ladies' instructions and expected that they would complete school. The motivation behind the BDM was to show ladies how to think about their wellbeing so they could get ready for parenthood and raise the same number of infants as the German populace required thus they stayed faithful to his Nazi system. All in all, Hitler utilized these gatherings as a chance to spread his thoughts all through the country, and to make another age that would be steadfast and brought together. He gave those under he's lessons an incredible separations of every Jewish individuals and instructed them that they were an unrivaled race. He accepted that the eventual fate of Nazi Germany were the youngsters and anticipated that kids should resemble: â€Å"The frail must be etched away. I need youngsters and ladies who can endure torment. A youthful German must be as quick as a greyhound, as intense as cowhide, and as hard as Krupp's steel.††Adolf Hitler (http://www.historylearningsite.co.uk/hitler_youth.htm) What's more, the gatherings wore made for this very reason to serve him if any uprising happened. He prepared youngsters at such a youthful age as they wore effectively powerless to debasement from Hitler's words and they wore encouraged that he was a hero for the entirety of Germany so the kids admired him as though he was a divine being so they would stay faithful to him later on. Clarify the explanation behind Nazi arrangements towards Women b) Women are the establishment to an incredible new age and Hitler came to appreciate this reality, to make an extraordinary new Germany he would need to control and convince ladies to remain at home and raise enormous families, he considered ladies to be just fit for parenthood and every one of his approaches mirrored that he needed ladies to be just used to make another age of youngsters faithful to Hitler's inheritance. To pass on his arrangements every equivalent right towards ladies in the Weimar Republic were abrogated. There was for all intents and purposes no uniformity as Nazi's accepted that ladies had a job that was independent to that of the men so balance was not in the inquiry, they said each sex has various assignments to do and their own different rights and through this the Nazi's accepted they wore being equivalent.. Hitler went of laws which guaranteed that ladies satisfied their obligation at home and organizations were urged to give all free activity spaces to men. The principal instances of ladies this happened to were ladies specialists and government employees. Hitler likewise permitted no lady to be an appointed authority or examiner as he suspected they couldn't think intelligently and without feeling. Hitler required ladies at home so they could have additional time on their hands to hoping to raise a family so the German populace would prosper. Nazis had explanations behind their disparity towards ladies in the public eye as they suspected their place was particularly in the home as youngster bearers and supporters of their spouses. Nazi approaches for ladies depended on the ‘3 K's, Kinder, Kirche, Kuche' (Children, Church and the Kitchen) and energized these arrangements by offering credits, family remittances and kid dies down for ladies to remain at home and were additionally given awards on the off chance that they had an enormous family. By urging ladies to do this and offering compensations for enormous families Germany's populace would develop meaning increasingly little fellows being prepared to being warriors and progressively little youngsters transforming into moms so Hitler can fill the land he was wanting to assume responsibility for with Germans. Despite the fact that there were a few exemptions to the strategies set by the Nazi's, as though you was a lady of high significance and firmly connected to Hitler by and by there was a few contrasts. For example, the movie executive Leni Riefenstahl, whom Hitler respected her work sincerely. At the point when he originally went to one of her movies showings, Hitler searched out the youthful chief and after a brief timeframe selected her as ‘Film Expert to the National Socialist Party'. Throughout the following five years Riefenstahl made a few movies wherein Hitler had mentioned, which in a state where ladies assumed an auxiliary job to men, Riefenstahl was given a free hand by Hitler to deliver publicity films for the Nazi system. Hitler portrayed Riefenstahl as ‘the immaculate German lady'. Another special case was Eva Braun which was Hitler's ‘wife' whom he wedded just when both had arrived at a shared choice to end it all daily after their marriage. Eva Braun met Hitler when she was 17 and at 19 years old At the age of 19, she turned into Hitler's escort, got a house, costly garments, quick vehicles and French fragrance †however no wedding band, she likewise was not driven into having kids which conflicts with Nazi strategies. Taking everything into account, every strategy set up concerning ladies in Germany was done as such for the sole reason that they would be fit and proficient moms, for example, being debilitated from thinning as this was viewed as terrible for labor. In spite of the fact that there were the special cases of a couple of ladies who Hitler permitted to lead an existence of extravagance and opportunity, giving them benefits that no other Nazi ladies could fantasy about encountering. ‘The most significant motivation behind why there was little restriction in Germany towards the Nazi system was its utilization of promulgation.' Explain how far you concur with this announcement. c) I consent to this announcement to all in all a far degree as I feel the Nazi system astutely utilized their utilization of purposeful publicity to influence the hearts and psyches of the German individuals. Through their unlimited oversight of the media the Nazi's wore ready to persuade individuals that they are correct or were winning the war therefore picking up trust all through Germany. They wore additionally ready to blue pencil any accounts or articles which in someway dishonor Nazi forces. In any case, their utilization of duplicity in the media was not by any means the only explanation there was little resistance towards them, dread additionally had a significant impact in ending any restriction the Nazi's would some way or another need to confront. Hitler had chosen Joseph Goebbels as priest for ‘National Enlightenment' and he controlled the media and expressions. It was his job to ensure that the media printed Nazi belief system and blue-penciled some other thought's advanced. He likewise set up the ‘Reich Chamber of Commerce' in 1933 and this was intended to manage all writing, workmanship, music, radio and so on and just the individuals who was a piece of this chamber was permitted to deliver anything from those classifications however close by these confines was the dread of discipline to contradict and of the arrangements set up so you could just peruse, see and hear what the Nazis needed you to. The utilization of oversight saw that there was practically no restriction in Germany as when Hitler came into power the Nazi's indicated what might befall things that didn't adjust to Nazi belief system and Goebbels sorted out mass book consuming meetings in which any book that didn't concur with Nazi thought's was taken o
Friday, July 10, 2020
Essay Topics For The Immortal Life Of Henrietta Lacks
Essay Topics For The Immortal Life Of Henrietta LacksEssay topics for the immortal life of Henrietta Lacks will help you write an excellent essay. These topics will show you how to effectively work your ideas into an interesting and well-written essay. It is highly recommended that you take a look at these topics before you begin writing your essay.If you want to write the perfect essay, there are numerous tips that can be utilized. These tips include getting your thoughts on paper, making sure that your essay is well researched, and starting to write an essay the day before. If you start writing a bit early, you will not run out of ideas to write about. A few people may ask you how to write an essay. If you have taken these steps into consideration, you will find that the best essays are written every time.List a series of questions in your essay. This will help you write an essay that is well researched and interesting. Some of the questions that you can list in your essay are: Wha t are Henrietta's strengths?What do you know about Henrietta? What were her favorite foods? What was she afraid of?What is it about Henrietta that people remember her for? What was her most admired quality? When was the last time that she laughed?Then list a series of character traits for each person you interviewed. Describe their habits and preferences. By doing this, you will see that the essay has all the proper documentation that will aid you when you send it off to be published.Her life was one filled with hopes and dreams. But she lived life because she lived it fully knowing that all she wanted was to help others achieve that goal.
Wednesday, May 20, 2020
Drug Development Of The Drug Imatinib - 1050 Words
TRM6002 Essay 2 – Drug Development State what the target for the drug imatinib is, and why that target was a good choice for a drug discovery project. Summary/Abstract: Until the 1990’s, drug discovery relied on forward pharmacology where trial and error produced medications that were usually involved in changing DNA synthesis and/or cell division. These medications were efficacious, but had issues with systemic toxicities due to their non-selectivity of diseased cells or disease causing proteins. With the discovery of specific genetic changes that occur in Chronic Myeloid Leukemia, a haematological malignancy, a target was identified which was only seen in diseased cells; thus, rational drug design came about. Imatinib is the first medication of rational drug design with action only in diseased cells. Introduction: Historically, drug discovery projects were aimed at developing drugs that were involved in changing DNA synthesis and/or cell division. These medications included alkylating agents which were very effective but due to the large range of non targeted action within the body, had multiple side effects and toxicities. Since the discovery of specific and varied genetic changes that can occur within cancerous cells, the approach to drug development has changed significantly. Imatinib was one of the first drugs developed where its site of action was only on diseased but not on non-diseased cells. Discussion: Drug discovery programs start when there is aShow MoreRelatedChronic Myeloid Leukemia1139 Words  | 5 PagesRegarding our recent inquiry as to the viability of an Abl-Bcr inhibitor and the marketability thereof, it is of prudent management to discern the separation between our drug candidate and those drugs currently existing in the market, and evaluating the ease of development as well as long-term payoffs of said inhibitor. First, however, an introduction to chronic myeloid leukemia, its symptoms and diagnoses, as well as current treatments, is in order. In better understanding the disease, we can moreRead MoreOrphan Drug Report627 Words  | 3 PagesOrphan Drug Report An orphan drug is a drug designed to treat a rare disease or condition. For a drug to qualify for orphan status both the drug and disease or condition must meet certain criteria specified in the Orphan Drug Act (ODA). This designation would qualify the sponsor of the drug for developmental incentives which includes waiving of regulator fees, faster or simpler clinical trial and approval process, tax credit or grants to offset research and development, and a period of marketingRead MoreAnilinoquinazoline Mechans Of Egfr918 Words  | 4 Pagessignificantly with increased angiogenesis with poor prognosis in NSCLC (Shikada et al., 2005; Kojima et al., 2005). Initial studies show that the combination of bevacizumab and chemotherapy increase the overall survival of advanced colorectal cancer. The drug development strategies added small molecule tyrosine kinase inhibitors for the antiangiogenesis. One preclinical study identified that the combination of bevacizumab and the anti-EGFR TKI Erlotinib are inhibit the receptor like VEGFR and EGFR pathways inRead MorePrice Matter At Customers : Drugs And Treatment For Chronic Myelogenous Leukemia ( Cml )845 Words  | 4 Pagesaffordability of their treatments. For some of the newest treatments on the market, drug prices, and subsequently patient costs, have reached unsustainably high levels. There is no denying that drug development has improved the lives of patients. â€Å"Rational drug design†, the process of developing medications based on the identification of a specific biological target, has produced promising new medications. For instance, Gleevec (imatinib) is a treatment for Chronic Myelogenous Leukemia (CML). In contrast toRead MoreEssay On Sunitinib1480 Words  | 6 Pagesstable disease for at least 12 weeks in 17 % of DTC and 38 % in MTC patients [18]. Imatinib is a TKI that garnered much attention for its highly favorable effect on chronic myeloid leukemia and has inhibitory action against PDGFR-a and PDGFR-b, c-KIT and RET. It has been shown to reduce RET-mediated cell growth of MTC cells [19]. It was investigated in two trials: phase I in which MTC patients treated with imatinib combined with dacarbazine and capecitabine did not report objective responses and phaseRead MoreAdvances in the Pharmaceutical Industry571 Words  | 2 Pagesadvances in the pharmaceutical industry increase as well. While most companies use the mentality of screening drugs that show the most binding affinity or particularity of drug applicants to a single defined target, this is not always the best way of doing things. Many off target activities or multi-targeted particularities have been successful in targeted therapeutics. For example, Imatinib marketed by Novartis and Sorafenib co-developed and co-marketed by Bayer and Onyx Pharmaceuticals and NexavarRead MoreThe Impact Of Traditional Chemotherapeutic Agents On Patients2189 Words  | 9 PagesIn contrast to a decade ago, we’ve seen an explosion of new drugs and virtually all of these drugs are targeted therapies. The substantial increase in the transition of FDA approvals from standard chemotherapeutics to targeted therapies is also equally astounding (Martino et al., 2015). The traditional chemotherapeutic agents are simply not being developed with the same frequency by drug companies any more. While chemotherapeutics have had a real impact and in some diseases a dramatic impact, forRead MoreWhat Would I Do If My Friend Had Leukemia?2592 Words  | 11 Pageskinase. Drugs known as tyrosine kinase inhibitors (TKIs) that target BCR-ABL are the standard treatment for CML. These drugs include Imatinib, Dasatinib, Nilotinib, Bosutinib, and Ponatinib. All of these drugs can have serious or even deadly interactions with other drugs, over the counter supplements, and even certain foods (such as grapefruit and pomegranates). The most common method used for treating Chronic Myeloid Leukemia was Interferon-Alpha. This substance reduces growth and development of leukemiaRead MoreChronic Myeloid Leukemia ( Leukemia )1270 Words  | 6 Pagesmany without these risk factors have will develop leukemia. Treatments can include chemotherapy, to kill the mutated cells in the body, radiation therapy, where high beams of energy are used to stop the further growth of malignant cells, and certain drugs that can target specific weaknesses in the cells again slowing and stopping further growth and proliferation. All of these therapies are dependent on the patient, his or her health, the severity of the disease and type of leukemia. Stem cell therapyRead MoreChronic Myelocytic ( Or Myelogenous ) Leukemia ( Cml )1290 Words  | 6 Pagesin DNA that turn on oncogenes (genes that promote cell growth and division) or turn off tumor suppressor cells (genes that slow down cell division or encourage apoptosis). CML is due to the formation of a new oncogene. The process involves the development of abnormal chromosomes, the abnormal chromosome creating a new fusion-gene, and the fusion-gene creating a protein that triggers cell division of diseased blood cells (Mayo Clinic, Hehlmann et al. 2007). During mitotic cell division in the myeloid
Wednesday, May 6, 2020
Terrorism And Its Effects On The United States - 1776 Words
Preventing Terrorism in the United States is a hard thing to overcome, but the government is trying their best to control and prevent terrorist attacks from happening. â€Å"The terrorist attacks on September 11, 2001, were a turning point in American history and demonstrated that the government must have the authority necessary to defend against future attacks, including the right to use the best technology to intercept potentially conspiratorial communications (Jacobs and Newton 1). Having advanced technologies in the United States can prevent Terrorism from happening. Terrorism must be overcome and be eliminated. The government of the United States will do this by having updated, and more advanced security around high populated places such†¦show more content†¦Supporters of the surveillance program argued that wiretaps are a necessary tool for preventing terrorist activity. Some argue that the current process of judicial review and oversight is obsolete given the nature of the terrorist threat, and that the president has been forced to engage in aggressive measures to ensure national security (Jacobs and Newton 2). The first ever used wiretap in the United States was invented before the telephone. Law enforcement started eavesdropping on telegraph communications in the 1860s. Several states made it illegal to â€Å"eavesdrop†on other peoples telegraph communications. Telephones and wiretapping was common in the United States by the 1890s. Some of the media criticized the government for allowing wiretapping without permission. Phon e companies stopped helping authorities with wiretapping because they didn t like how they were using it. Most states banned the wiretapping while other states needed a court approval before they could wiretap telephones. Furthermore, the US Constitution includes no express right to privacy. In order to invoke the right to privacy under the Fourth Amendment, a US citizen must demonstrate a reasonable expectation of privacy. However, the NSA s collection of telephone metadata and monitoring of Internet activity do not interfere with US citizens reasonable expectations of privacy. Because individuals rely on a third party (such as the telephone company or Internet service provider)
Human Genome And A Look Into Schizophrenia Biology Essay Example For Students
Human Genome And A Look Into Schizophrenia Biology Essay Unphased determine whether a familial discrepancy is associated with a disease or trait. If association is present, a peculiar allelomorph, genotype or haplotype of a polymorphism or polymorphism ( s ) will be seen more frequently than expected by opportunity in an single transporting the trait. instance ( Schizophrenia ) and control ( normal ) . frequence of allelomorphs or genotypes is compared between the instances and controls. One job with the case-control design is that genotype and haplotype frequences vary between cultural or geographic populations. We will write a custom essay on Human Genome And A Look Into Schizophrenia Biology specifically for you for only $16.38 $13.9/page Order now After the gel cataphoresis, the PCR merchandises were added with 40I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 2 hours, this is to precipitate out the amplified fragment of DNA. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 minutees. The rinsing procedure was repeated one time more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Milli Q H2O was added to each of the dried sample and heated at 60a„? for 1 minute for blending the H2O and PCR merchandise. Deoxyribonucleic acid Sequencing The stuff used in the Deoxyribonucleic acid sequencing reactions include: primer, either frontward or change by reversal ; 5X Seuqencing buffer ( Applied Biosystems ) ; PCR merchandise ; and Milli Q H2O that to do the entire volume into 15I?l. The Deoxyribonucleic acid sequencing initiated at 95a„? for 5 proceedingss. Each rhythm contains 30 seconds at 95a„? for denaturation, 30s at tempering temperature for each brace of primer for tempering of primer to template DNA, 1 minute at 72a„? for elongation of the merchandise. In the experiment, 30 rhythms were completed for each brace of the primers. Following the reaction rhythms, there was 5 proceedingss at 72a„? as concluding elongation clip. And the reaction merchandises were temporarily stored in the machine at 4a„? as the concluding clasp temperature. 0.72I?l of primer, 3I?l of sequencing buffer, 0.75I?l of Big Dye Terminator version 3.1 ( Applied Biosystems ) , 1.5I?l of PCR merchandise sample and 9.03I?l of Milli Q H2O were made up into reaction mixture. Primer Sequence B22f1S TTAAGCACAGCTACTAGATC B22r2 CAGGGAGGTAGGAATGAGAATCTG B22r2S TTCCCTGGGATTATACATAT B22f3 TCTTTGAGTTATCAGGATTGGG B22f4S ACCATTCTTAATGAATTCCA Table 2: Primers used in sequencing. hypertext transfer protocol: //wpcontent.answers.com/wikipedia/commons/thumb/d/df/DNA_Sequencin_3_labeling_methods.jpg/220px-DNA_Sequencin_3_labeling_methods.jpg Figure 2: Conventional drawing of DNA sequencing. Sequencing Product Purification The sequencing merchandises were added with 48I?l of 100 % ethyl alcohol and set into -20a„? icebox, for at least 30 proceedingss, this is to precipitate out the Deoxyribonucleic acid fragment. Then, the mixture was centrifuged at 3000rpm for 30 proceedingss. After remotion of the liquid waste, 24I?l of 70 % ethyl alcohol was added to rinse the sample, and centrifuged at 3500rpm for 20 proceedingss. The rinsing procedure was repeated twice more. After that, the samples were dried under 10Pa of force per unit area for 20 proceedingss. 10I?l of Hi-Deionized formamide was added to each of the dried sample and heated at 95a„? for 3 minute to denature. Consequences Consequences generated by Genepop , By utilizing Hardy-Weinberg equilibrium, we try to prove if the population ( Beijing ) used in the experiment is in equilibrium. Control sample from normal individuals was used to run the Genepop plan. Venue P-value Standard Error W A ; C R A ; H Stairss rs252973 1.0000 0.0000 -0.0395 -0.0398 14657 switches rs10050588 1.0000 0.0000 -0.0055 -0.0056 68379 switches rs171677 1.0000 0.0000 -0.0282 -0.0284 7920 switches rs252975 1.0000 0.0000 -0.0337 -0.0339 10920 switches rs173767 1.0000 0.0000 -0.0440 -0.0442 17820 switches rs153298 0.6843 0.0035 -0.0583 -0.0586 83991 switches rs153299 1.0000 0.0000 -0.0440 -0.0442 18138 switches rs252976 .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49 .postImageUrl , .u0973effd93375e50281bda78684f0b49 .centered-text-area { min-height: 80px; position: relative; } .u0973effd93375e50281bda78684f0b49 , .u0973effd93375e50281bda78684f0b49:hover , .u0973effd93375e50281bda78684f0b49:visited , .u0973effd93375e50281bda78684f0b49:active { border:0!important; } .u0973effd93375e50281bda78684f0b49 .clearfix:after { content: ""; display: table; clear: both; } .u0973effd93375e50281bda78684f0b49 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u0973effd93375e50281bda78684f0b49:active , .u0973effd93375e50281bda78684f0b49:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u0973effd93375e50281bda78684f0b49 .centered-text-area { width: 100%; position: relative ; } .u0973effd93375e50281bda78684f0b49 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u0973effd93375e50281bda78684f0b49 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u0973effd93375e50281bda78684f0b49 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u0973effd93375e50281bda78684f0b49:hover .ctaButton { background-color: #34495E!important; } .u0973effd93375e50281bda78684f0b49 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u0973effd93375e50281bda78684f0b49 .u0973effd93375e50281bda78684f0b49-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u0973effd93375e50281bda78684f0b49:after { content: ""; display: block; clear: both; } READ: Gamelan - Music of Indonesia Essay1.0000 0.0000 -0.0444 -0.0447 18232 switches rs1849173 0.8343 0.0016 -0.0430 -0.0432 83419 switches Table 3: Consequences generated from Genepop. Two estimations of Fis: Weir A ; Cockerham s ( 1984 ) estimation ( W A ; C ) , and Robertson A ; Hill s ( 1984 ) estimation ( R A ; H ) . All ( Fisher s method ) : Chi2: 1.1210 ; Df: 18.0000 ; Prob: 1. Under the rule of chance, if the P value is less than 5 per centum, the two Numberss are said to be significantly different, the void hypothesis, in this instance the random brotherhood of gametes, is rejected. From the above tabular array we can see that all SNPs tested have p-value larger than 0.05 ; that is the population at the selected venue is expected to be in equilibrium. As we will compare the differences of SNPs between Schizophrenia patients and normal individuals, the consequences generated by Genepop can except the fluctuation between cultural or geographic populations. The standard mistake of this estimation is much less that 0.01, and the consequences from the appraisal are expected to be dependable. Consequences generated by Haploview Linkage disequilibrium describes a state of affairs in which some combinations of allelomorphs or familial markers occur more or less often in a population than would be expected from a random formation of haplotypes from allelomorphs based on their frequences. Fig3: Haploview show of Schizophrenia patients Fig 4: Haploview show of control group Discussion Sample size
Thursday, April 23, 2020
Internet Cafe Ban in manilenos minor Essay Example
Internet Cafe Ban in manilenos minor Essay Background of the Study: School is where students develop skills that help them interpret and adapt to a changing world. This is the place where they are developed and save from vices. Unfortunately, due to the inclusion of technology, students particularly minors, are addicted to the computer games that cause to the cutting classes and worst drop out. Almost everywhere you can see internet Cafe that allow rent computers to anyone. Computer Gaming is one of the main attraction in computer shops that cause addiction to the users or players. This was known as Computer Addiction. Due to the increasing number of minors that are skipping in the class, the government make an action to solved this problem. The Manila City Council passed an ordinance that will prevent the minors in entering to the computer shops with in am to pm, weekdays. The ordinance was created by Executive order no. 14 and City Ordinance no. 8168 on 2007 by Former Manila Mayor Alfred S. Limit. This is intensified the drive against computer shops that allow accessing the students during class hours. This authorizes the parents and teachers to inspect computer shops and internet cafe, if they allow minors inside the shop. We will write a custom essay sample on Internet Cafe Ban in manilenos minor specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Internet Cafe Ban in manilenos minor specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Internet Cafe Ban in manilenos minor specifically for you FOR ONLY $16.38 $13.9/page Hire Writer But only officers of accredited parents and teacher association are assigned to inspect and monitor the shop. They have the authority to take pictures and get the names of the minors, the owner of the shop and the names of the parents. The reports are then goes to the mayor and upon approval of the mayor the license of the shop to operate will be revoked. On the other hand, the identities of the minors are keep safe, for confidential purpose. This ordinance also erred every computer shop to attach No to Pornography and Gambling sign to every computer and that there should be no cubicle or no enclosed separating each computer. There should also be sign on the door stating that Minors and Students are not allowed to enter during Class hours. The implementation of the ordinance aims to give managements of internet shops some rules that will save the youth from computer game addiction that could affect their social well-being, morality and most especially their education. This ordinance is within the Jurisdiction of the City of Manila only. This is a great steps for the decreasing of the number of drop outs and skipping of classes of the minors and student. Here also stated in the ordinance that there is a penalty in breaking the elementary schools are established. This research is conducted for the purpose of identifying the effect of this ordinance in promoting the education of the minor students and to avoid the to the computer addiction that will affect their Studies. For academic purpose the research focus on the locality of selected barraging in Sample manila. V. Theoretical Framework: This study has described a Grounded approach to the design of programs to strengthen hybrid Justice systems that is attuned to local needs and opportunities. Five key steps were proposed: (l)understand the historical and contemporary political and policy context of formal and customary Justice systems; (ii) analyze the strengths and weaknesses of formal and customary legal systems; (iii) identify entry points for strengthening hybrid Justice systems based on an analytical framework of institutional change; (iv) realistically assess the opportunities for engagement on the entry points; and (v) ensure a flexible and long-term commitment to implementation. V. Conceptual Framework: The implementation of the Ordinance no. 168 in Manila City, prohibits the minors in entering in computer shops during school hours. The parents and teacher association are task to inspect the computer shops if they allowing minors to access the computer they own. This is for the promotion of the education of the minors and to save the minors from computer addictions. VI. Paradigm of the Study: VI. Objectives of the Study: MUST: To Identify the effects of the ordina nce no. 168 to the education of the minors. WANTS: To know the purpose of the ordinance. VIII. Statement of the Problems: (General Statement of the Problem): The study focus on the effects of ordinance no. 8168 to the education of the minors in sample manila. (Specific Problems): 1 . What was the characteristics of minors, in terms of: a. Age b. Sex c. Etc. 2. Does the Parents and Teachers Association are educated or knowledgeable to the 4. What are the effects of the implementation of ordinance no. 8168 to the education of the minors? X. Hypothesis: Ha: There is significance between the Ordinance no. 8168 to the education of the minors. Ho: There is no significance between the no. 168 to the education of the minors in Sample Manila. X. Research Design: The Method of research used in this study is Descriptive Method. This Method describes and interprets the present situation and practices in society. Descriptive research Describes and interprets what is. That is concerned with the prevailing practices (Best). In this Research, the intended to be interpreted is the implementati on of the City ordinance 8168. This study will primarily determine the effects of banning the minors in computer shops or internet cafe in the Academic performance of the students of . X. Significance of the Study: The researcher hopes that the result of this study would contribute to the better learning of the minor students. The following are the sectors that affected and gain significant information on this study: 1. To the Minors = this will provide them an information on how important is the Ordinance to their Studies. 2. Parents and teachers association = this is important for hem because it can give them a feedback on how well they are performing the ordinance. 3. To the City Council= For them to evaluate the law, and serve this as their basis in upgrading improving the ordinance. 4. To the Future Researcher: this will serve as their related study in conducting their research. This will also provided information to them on how important is the Ordinance in the academic performance of the Minor students. 5. To the Readers= this will provide them an information to increase their awareness on the ordinances exist in Manila for the welfare of the Minors.
Tuesday, March 17, 2020
Stanford Acceptance Letter Real and Official
Stanford Acceptance Letter Real and Official SAT / ACT Prep Online Guides and Tips Each year, Stanford Universityreceives over 40,000 applicationsfrom high school hopefuls. Only5% of them get a Stanfordacceptance letter.For example, in 2015, Stanfordaccepted 2,144applicants from a record 42,487applications for the Class of 2019. That’s atiny5.0% admission rate.Unfortunately, the overwhelming majority of applicants get a rejection letter. â€Å"I regretto inform you†¦Ã¢â‚¬ When I was in high school, I was one of the lucky few to apply to Stanfordand receive an acceptance letter in the mail. This validated years of hard work and made me proud that a school like Stanford wanted me as part of their community.Here’s my complete, official Stanfordacceptance letter. Want to learn what it takes to get a Stanfordadmit letter yourself? Read my How to Get Into Harvard and the Ivy League guide. I'll take you through the philosophy behind how to become the world-class student that schools like Stanford, Harvard, and Princeton are looking for. You'll learn what it means to develop an application Spike, why being well-rounded is the path to rejection, and how to craft a compelling application yourself. Read this guide now before it's too late. Here's a scan of the original admissions letter sent to me by the Office of Undergraduate Admission at Stanford University. Even though I decided to attend Harvard, it was a really tough choice to turn down Stanford. It has an energetic, open environment and great location in the Bay Area. In retrospect, with my current interest in entrepreneurship, it might have been really interestingto attend Stanford. Afterward, I'll give you tips on what it takes for you to get an acceptance letter like this for yourself. Stanford University March 2005 Dear Allen, Congratulations! It is with great pleasure that I offer you admission to the Stanford University Class of 2009. Your thoughtful application and remarkable accomplishments convinced us that you have the intellectual energy, imagination and talent to flourish at Stanford. Among the over 20,000 applications we read, your distinguished record of academic excellence and personal achievement stood out. We are thrilled to welcome you to the Stanford community and look forward to the unique and extraordinary contributions we know you will make to the intellectual and extracurricular life of our campus. The exciting next step is now yours. As Stanford is probably only one of several options you will consider in the coming weeks, I hope you will use the time to learn more about us. We invite you to participate in Admit Weekend 2005, a three-day program that will introduce you to the intellectual vibrancy and dynamic campus life that define Stanford. Information about that event is enclosed. Whatever decision you make, we ask that you complete the enclosed enrollment response card and return it to us by the postmark deadline of May 2, 2005. Should you decide to matriculate at Stanford - and we sincerely hope you do - we will send enrollment information to you in late May. While we have every reason to believe you will complete this school year successfully, remember that your admission is contingent upon your continued strong academic performance in the program you presented to us in your application. Once again, I extend my congratulations on your admission to Stanford and welcome you to the Stanford family. Sincerely, Anna Marie Porras Director of Admission (Bring your light saber to Stanford!) The lightsaber comment is a reference to my Stanford supplemental essay. Want to build the best possible college application? We can help. PrepScholar Admissions is the world's best admissions consulting service. We combine world-class admissions counselors with our data-driven, proprietary admissions strategies. We've overseen thousands of students get into their top choice schools, from state colleges to the Ivy League. We know what kinds of students colleges want to admit. We want to get you admitted to your dream schools. Learn more about PrepScholar Admissions to maximize your chance of getting in. OK....so now what? You probably have a reason forlooking at this acceptance letter. Let me try to help you out. If you just received a rejection letter from Stanford, I'm sorry. When admissions officers say deciding between students is really tough, they're speaking the truth. The good news is that you're in command of your future. There are Stanfordgraduates who end up lostin life, and there are graduates from hundreds of other colleges (and even people who never went tocollege) who end up with amazing achievements. You're in control of your own fate. So if you're disappointed about a Stanfordrejection, I hope you pick yourself up and excel from this point forward. Here's a guide on how to get great grades in collegeand prepare yourself for the future. If you're planning your college application and want to apply to Stanford, I hope this acceptance letter inspires you to want your own. Make no mistake, it took a lot of hard work to get to the point where I felt I was likely to pass Stanford's tough admission requirements. Throughout high school, I had to strategize carefully and spend my time effectively so I could balance great grades,AP coursework,hightest scores, and deep extracurricular activities. To help you out,I've written everything I know about succeeding in high school and college admissions. If you want your own Stanford acceptance letter, these are must-read guides: 1) How to Get Into Harvard, Stanford and the Ivy League This is the most fundamental guide to help you understand what top colleges like the Ivy Leagues are looking for. Here you'll learn: what kinds of students are most attractive to Stanfordand why why being well-rounded is the path to failurein selectivecollege admissions what a Spike is and why an effective Spike will get you admitted to every college how you can develop your own compelling Spike I'm not saying it's easy, because it's not at all trivial. But in my experience with many thousands of students across the country, far too many have the wrong idea about what colleges actually want. In the process, most studentswaste far too much time on things that aren't important and do nothing to raise their admissions chances. Even worse, they end up miserable and stressed all day. That's why I wrote this guide. Read it before it's too late - it mighttotally change your high school strategy. 2) My Complete Successful Application, including Common App and Supplement To complement my "How to Get Into Stanford" guide, I share my entire college application, page by page, word for word. You'll see the exact application that the admissions committee at Stanfordsaw, including the Common Application, my personal essays, letters of recommendation, and transcript. I also provide commentary on every piece of my application. You'll see what was REALLY important to get me into Stanford,and other things that weren't. You'll even see mistakes I made in my application. I've never seen anyone else provide this level of analysis and detail,so I believeyou'll get something out of it. 3) How to Get a 4.0 GPA and Better Grades Your coursework is a critical componentof your college application. Not only do you need great grades, you need great grades in whatStanford says is "among the most demanding courses available at your school." Thus it's no surprise that a lot of high school students are stressed out and anxious. Do you ever feel like you're taking too many AP courses and struggling to balance everything? The biggest problems I see in the students I work with are in mindset, habits, and strategy. To help students out, I've written a complete guide onhow to excel in high school coursework. I take you through three levels of detail, from high to low: Mindset and Psychology: Do you have the confidence to know you can even improve? Are you prepared to work hard? Overall Planning and Habits: Do you make the most out of every hour? Do you understand what teachers care about, and how to give them what they want? Do you know how to avoid procrastination? Individual Class Strategies: How do you excel in English classes? How is this different from math and science classes? I learned a lot of these lessons the hard way, throughout high school and college. This is the guide I wish I had before starting high school. Take the time to read it and you might get better grades while saving hundreds of hours of study time. 4) How to Get a Perfect SAT Score/ How to Get a Perfect ACT Score As you already know, besides GPA, theother major number on your application isyour SAT/ACT score. This score isso important because it compares you to high school students across the country on even ground. Top schools like Stanfordexpect you to be in the top 1 percentile of the country. If you're not, you'll cast serious doubt on your academic ability and your ability to thrive at Stanford. In my perfect SAT and perfect ACT guides, I share the major strategies that you'll need to boost your score above a 2100 on the SAT and 32 on the ACT. Also, check out my series on getting perfect scores in each of the sections on the SAT/ACT: SAT 800 Series: Reading | Math | Writing- Learn important strategies to excel in each section of the SAT. ACT 36 Series: English | Math | Reading | Science - Learn how to get a perfect 36 on each section of the ACT. Want to improve your SAT score by 160 points or your ACT score by 4 points?We've written a guide for each test about the top 5 strategies you must be using to have a shot at improving your score. Download it for free now:
Saturday, February 29, 2020
Black Boy Essay Research Paper Black BoyWhen
Black Boy Essay, Research Paper Black Boy When a individual thinks about hungriness, nutrient comes to mind. We neer think of hungriness as anything else. In Richard Wright # 8217 ; s book Blackboy, a immature male child faces many different types of hungriness. He refers to the phrase # 8220 ; American Hunger # 8221 ; throughout his book. I feel that the # 8220 ; American Hunger # 8221 ; which he is mentioning to is the hungriness to be considered an American and be treated as an equal. Throughout his life he was treated as if he were from another planet. He was ever considered to be different, an castaway and a also-ran. He felt the demand to be a portion of the alleged American Culture. He wanted to be able to make what the white kids did. He wanted to be able to travel to school, to larn, to read, hold friends, have a occupation ; but because he was an African American he could non. This is what I will be discoursing, his hungriness. Hunger is non the merely hungriness he felt. He felt many other types of hungriness throughout his life. His hungriness came about when his male parent left his household hungering which led to Richards physical hungriness. He feels as though it is his occupation to back up and assist his household since his pa left. By reading and larning through colleagues he learned how to cover with others, whether they are black or white. He learns the secret of how to last in his society by watching how others act and react to one another. An illustration of this is when Richard is in the lift and the black get says # 8220 ; Watch this. I will acquire a one-fourth # 8230 ; # 8221 ; So the child lets a white adult male kick him in the buttocks every bit hard as he can merely for a one-fourth. This secret is what keeps him alive, places him in society where he belongs, and lets him populate out is dream of going a author. Richard was so eager to larn that he kept invariably inquiring inquiries, and if his inquiries were left unreciprocated he would allow his imaginativeness take over.. He would seek to happen work in which he would be able to read some of the B ooks. His household and relations refused to allow him larn. There is one incident in which his school teacher read to him. His grandma got angry and said that reading was devils work. Through out his childhood he heard many footings and phrases. He neer understood what they meant but one time they were said he knew if they were good or bad. For illustration, when Richard was taking a bath and his grandma came in to scour his rear, Richard replied with, â€Å"When you get through, snog back there.†This is merely one of the many phrases he said in which he did non cognize the significance. Richard’s grandma flipped and wanted to crush Richard for what he had said. Richard had learned that phrase from school and didn’t know the significance. Through his avidity to larn he began to understand himself, other inkinesss, and Whites better. He continues to larn and to play dumb for his ain endurance. His self instruction began when a colleague Lent Richard his library card to read Mencken # 8217 ; s essays. He eventually got a interruption from a white adult male who trusts Richard and is willing to allow him read what he wants to read. He lets Richard # 8220 ; feed his hungriness, # 8221 ; He feels that his dreams and his narratives in which he reads are an flight for him. He wants to suit in with others and be able to be apart of America. He feels the demand to travel to school because it is his aspiration to go a author. His reading puzzled his Aunt Maggie for she could non understand why person would be reading merely for merriment because they liked it. Through out the book Richard tries to feed all his hungriness so that he isn # 8217 ; t hungry any longer. Not in the sense of nutrient but the sense of cognition. Back so it was difficult to be the colour black and survive and learn. Race was a large thing and could hold gotten him killed at any clip. But Richard learned organize his errors and other peoples errors and overcame many obstructions. He is a nationalist a hero a MAN. I feel that Richard had # 8220 ; kept himself full! # 8221 ;
Thursday, February 13, 2020
Customer Service Software and how it provides tools used in enhancing Essay
Customer Service Software and how it provides tools used in enhancing customer service - Essay Example An excellent customer service ensures that the customers know the services expected from the organization, and the organization should ensure high quality information about the regular customer needs. The company management should be easily accessible, and response should be fast. Customer service provides a framework in the creation of commendable customer relationship within the organization. Customer service creates trust and loyalty between the organization and the customers transcending moment interaction. Mostly, complaining psychology ensues as measurement for crises ad opportunities (Kelshall 2009, p.223). Customer service entails all the activities that enhance high level customer satisfaction by ensuring the services and the product meet the customer expectation, and it enhances income and revenue generation. Customers and the Organization Customers can be regarded as key stakeholders to every success within an organization. The constant drive in customer satisfaction is th e duty of all people within an organization. The appreciation of the employees in organizations takes place regardless of whether the link is direct or indirect. Many organizations consider the customer role as the prime. This happens through corporate training programs and improved communication techniques. Customer satisfaction by an organization requires maintenance of the customer contacts. Marketers enhance customer satisfaction through market survey and research to offer insights on the new services and products sought by the customers (Rao & Madhavi 2004, p. 38). Customers influence the decision by the marketing team towards decision making. Customers are crucial determinants of profits and revenues and ensure job security within an organization. Therefore, viability of an organization measured based on the potential of an organization to attract customers. Provision of excellent customer service is the paramount goal of an organization (Chung 2006, p. 10). Customer satisfact ion and the client retention Customer retention ensures continued business relationship between the customer and the firm. On the other hand, customer satisfaction is the measure of the surpassing power of goods and services by an organization to customer expectation. Commendable customer satisfaction accompanies loyalty. The organization with high customer satisfaction pays little attention to the advertising from their competitors. Satisfaction influences repurchasing intention and ensures customer retention. Unsatisfied customers may continue their patronage based on fear of shifting to other alternatives. Fear is created by the unawareness of the other services elsewhere, especially when using the repurchase intention in measuring the customer satisfaction (Kelshall 2009, p.224). Relationship between organization profitability and customer satisfaction Many studies indicate the correlation between the customer satisfaction and the organization profitability. Happy employees comm unicate well with the customers. The customers continue with their patronage. The relationship develops leading to continuous loyalty. Invariably, the defection rate reduces and acquisition of new customers results. Good customer service is critical in enhancing customer perceived value. The overall assessment of the customer on the product utility improves the customer loyalty. The customer perceived values influence the cost and the tastes of the customers. The interaction efficiency with the staff influences the perceived value
Saturday, February 1, 2020
Respond Movie Review Example | Topics and Well Written Essays - 250 words - 1
Respond - Movie Review Example After a long duration of attempting to provide answers to his questions, Tim formulated a thesis and his work brought to a halt the raising of more question and judgments. He concluded his research process convinced that Vermeer used optical devices to undertake his work in painting. Tim ultimately answered the numerous questions that he posed and that his critics could have raised. Through setting on a course to establish the techniques that a predecessor artist used in his work, one can say that Tim engages in a process of critical inquiry. To guide the endeavor, he had to pose critical questions that he was to provide their answers based on his research. However, Tim was successful in narrowing down the differences that existed in his initial views and Vermeer’s perception and techniques or tools of art. Through successfully answering his critical questions, he minimizes the broader discourse that would have existed between his perception and Vermeer’s views on the techniques and tools of art. Therefore, Tim harmonizes his views with his predecessor through confirming the validity of his thesis. Tim’s rhetorical situation is that he seems to become obsessed with work that was originally done by another artist. His situation leaves one wondering whether he lacks originality or whether he just needs to prove a point. The fact that he confi rms the techniques used in Vermeer’s work was not any different from what he thought is a sign that there is no discovery that he
Friday, January 24, 2020
Slow Food Essay -- Nutrition
The trend of the Slow Food Movement has existed since the 1970’s but has recently been thrusted into the fore front of prominent world issues as the cause and remedy of environmental challenges, local economic circumstances, and the complexities with social norms. The Slow Food Movement can be considered a counter-trend to Fast food. It was created in response to the augmentation of fast food a culture, the diminishment of people caring where the food comes from, and the diminishment of local food traditions. After a close examination of these factors, a prediction is made of the future trends of Slow Food Movement, and how the Slow Movement concept will evolve to become a part of everyday life. The Oxford American Dictionary defines trends as â€Å"a general tendency or inclination, the general direction in which something tends to move†(1999) A trend analysis is defined as an examination of a trend to identify its nature, causes, speed of development, and potential impacts (Cornish, 2001, p.78). Trends at times arise as a response to other trends. The same deduction can be made about food trends. For example when the Atkins diet was popular, retailers responded with low carbohydrate food options. In 2006, Burger King offered bunless burgers wrapped in lettuce, to appeal to the dieters embracing a low, or no carbohydrate lifestyle. Additional fast food restaurants including Arbys, Hardees, Carl’s Junior, and Subway followed suit with bunless options. While the trend of no or low carbohydrate diets have diminished the low carbohydrate options continue to be available upon request. The trend illustrates the affects trends have on each other. The Slow Food Movement has similar roots of establishment. The Slow Food Movement can be... ...ustry's Parade toward Low-Carb Menu Items. . Knight Ridder Tribune Business News 1(1), Retrieved Jun. 10, 2011, from from ProQuest Newsstand. (Document ID: 524271311). Schneider, S. (2008). Good, Clean, Fair: The Rhetoric of the Slow Food Movement. College English, 70 (4), pp. 384-402. Slow Food International. 1989. Slow Food Manifesto Retrieved from http://www.slowfood.com/international/2/our-philosophy "Trend n. & v." The Oxford American Dictionary of Current English. Oxford University Press, 1999. Oxford Reference Online. Oxford University Press. August 2011 US Department of Agriculture, Economic Research Service. 2008. U.S. Fertilizer Use and Price. Data set. Available atWeb site http://www.ers.usda.gov/Data/FertilizerUse/ (accessed 11 June 2011).
Thursday, January 16, 2020
The Pearl Characters Pen Portrait
Pen Portraits-The Pearl Juana- Juana is a very young lady and she has just had her first child. In the starting of the book, she is very calm and does not speak much. Towards the end of the book she is a lot more aggressive and speaks more than she used to. Her attitude changes and she stays by Kino whatever happens. An example is when Kino has killed a man; she helps him hide the dead body instead of telling anyone of the crime. Steinbeck also writes that when she carries out her way of curing Coyotito by putting the poultice on his sting, she does not have any faith in her technique and thinks that they should go to the doctor.This is the proof that tells us that she has a strong belief in authority. At the end of the book, she becomes very stubborn and this stubbornness leads to her son’s death. When Kino tells Juana that she should hide with Coyotito to stay safe, she says no three times without any hesitation or weakness. This is an example of her stubbornness. If she wou ld have hidden with Coyotito, the consequences could have differed. My opinion of Kino is that she was a very strong character and had a very large roll to play in this book.Her roll was not only protecting Coyotito, but she was also Kino’s largest support. Kino- Kino is a young man who thinks he will achieve everything after he gets the pearl. He has too many ambitions such as sending his son to school, getting married, and having a rifle. He tells his ambitions to all the villagers and the priest becomes even greedier after hearing what he can do with just a Pearl. Although the priest cannot do anything wrong as he is a religious man, the doctor can. He also sets himself some ambitions such as drinking wine in a rich restaurant.But to achieve his ambitions he must have the pearl. He tries to seal it but is not successful. Kino knows that on the way to achieving his ambitions he will have to face evil but he is too greedy and the greed makes him blind. All he can see are his ambitions. His foolishness is also a reason of his son’s death. If he would have sold it for 1500 pesos than his sons death could have been avoided, but as I have written, greed can make a person blind. In my opinion, Kino was trapped by the pearl and he can do nothing to get rescue himself from the pearls invisible trap.It is not every day that a man gets lucky. And when Kino gets lucky, he wants to make too much from the luck and this teaches him a lesson; â€Å"you should always be happy with what you have†. Juan Tomas- Juan Tomas is Kino’s bigger brother and his wife is Apolonia. Juan Tomas warns Kino about the consequences of what the pearl could do. Kino does not listen to his brother and very unfortunate consequences follow. For example, Juan Tomas says ‘there is a devil in this pearl’ but Kino knows this but instead of throwing it away, he keeps it as a hope, he keeps it as his soul.When Kino kills a man in self-defense, Juan Tomas and Apol onia hide Kino’s family. This shows us that Juan Tomas’ nature is very helpful although he knows that he is helping a criminal who could be sent to jail or even executed, he remembers that he is Kino’s brother and should always stay as a support for him and his family From my opinion, He is a very humble man and seems happy with his post in his life; yet, he understands Kino and why he wants to earn too much from the pearl. Juan Tomas, although he has a very short part to play, it is still a very important one.
Tuesday, January 7, 2020
Michigan State University and Texas Christian University...
Michigan State University Michigan State University is located in East Lansing, Michigan.It is a public research university. The colors of Michigan State University are green and white. Michigan is affected by the Great Lake’s region, winter and summer climate is moderate. Currently, Michigan State Universitys campus covers a total of 5,200 acres, of which two thousand acres have been developed. A total of 556 buildings on campus: where 100 academic purposes, 131 for agricultural purposes, 166 for the board uses 42 sports facilities. Michigan State University a total of 2,037, 464.3 square meters of indoor space. And there are a total of 43 kilometers of roads and 161 kilometers of sidewalks. Michigan State University campus also†¦show more content†¦In addition, minimum requirements for international students request that all secondary schools attended, colleges or universities attended, or examination boards send original or attested copies of all transcripts, diplo mas, mark sheets, and certificates directly to MSU in an official, sealed envelope. As an international student, you need to provide valid TOEFL scores and SAT scores as well. Academic merit scholarships are awarded for students. IELTS and TOEFL scores are admitted as a language proficiency. Regular admission for international students requests TOEFL’s score of 79 with no sub-score below 17 for internet-based test. For paper-based test, it request score of 550 with no sub-score below 52. Also, for IELTS, regular admission requires the score of 6.5 or higher. Besides regular admission, students, who do not have strong language skills, can apply for a provisional admission. Provisional admission requests that the score of TOEFL’s internet-based test is 60-78 and a score of 500-549 on paper-based test. The score of IELTS’s test is 6.0. Regular admission needs SAT critical reading scores which is 480 or higher. Academic merit scholarships are provided by MSU to attract the number of students to attend in. Alumni Distinguished Scholarship is awarded to the top 15Show MoreRelatedAmerican Middle Eastern Minority915 Words  | 4 PagesAmerican Middle Eastern Minority One of the least known minority groups in the United States is the Middle Eastern minority. Although the place of Middle Easterners became the forefront of public discussions recently, especially with relation to Islam and terrorism after 9/11, Middle Easterners in the United States have a long history. They have become part of the American society, and many second- and third generation Americans with Middle Eastern background have become publicly recognizableRead MoreSample Letter For Master Teacher936 Words  | 4 Pagestheir enthusiasm and their zest for life. 8. Can you tell me a little bit about your own education and family? I am the product of both private and public schools – Dallas Christian Schools (kindergarten), Dallas public schools, Abilene Christian University, Newman University, Ft. Hays (ESL); and Kansas State University (Master’s). I have also taken numerous courses at Dodge City Community College and have found that the educators there are as fine as those at any four year institution. AllRead MoreJosh Mcdowell1258 Words  | 6 PagesJOSH MCDOWELL Slide 2: * Josh McDowell is a Christian apologist, evangelist, and writer. He is within the Evangelical tradition of Protestant Christianity. * Born August 17, 1939 in Union City, Michigan with the given name Joslin, now he obviously goes by Josh and lives in California. * He was 1 of 5 kids born to Wilmot McDowell. * Struggled with low self-esteem as a result of an alcoholic and abusive father. * After being sexually abused by a hired farm hand from the agesRead MoreEducation Is The Most Powerful Weapon1541 Words  | 7 Pagesunderstanding that you get from attending a school, college, or university. In today’s society, education is dispensed and received through different forms: campus-based, internet-based, distance, and home education. Home education or homeschool means a nonpublic school conducted primarily by the parent, guardian or other person having custody of a child. Though all states in the United States permit parents to homeschool, some states (such as California) require homeschoolers to register as privateRead MoreThe Unfairness Of Standardized Tests Essay1566 Words  | 7 Pagescreated in 1959. Growing in popularity, both tests became accepted at many different universities across the nation. In more recent times, the use of standardized test scores as a major factor in admitting a student into a university has been questioned. This is due to the idea that standardized tests are not a suitable way to measure a student’s intellectual capabilities. Consequently, some colleges across the Unites States have decided to go test optional which decreases the importance of having a reputableRead MoreEducation Is The Most Powerful Weapon1598 Words  | 7 Pagesunderstanding that you get from attending a school, college, or university (1). In today’s society, education is dispensed and received through different forms: campus-based, internet-based, distance, and home education. Home education or homeschool means a nonpublic school conducted primarily by the parent, guardian or other person having custody of a child (2). Though all states in the United States permit parents to homeschool, some states (such as California) require homeschoolers to register as privateRead MoreAffirmative Action: Then vs. Now4130 Words  | 17 Pageshad not been faced with any major problems until the 1970s when the first outcries o f reverse discrimination began to surface. Allan Bakke brought one of the first and most popular cases. He was a 34 year old Caucasian who had applied to The University of California at Davis Medical School twice. Both times he had been rejected even though he had a 3.44 GPA on a 4.0 scale and his MCAT scores placed him in the 72nd percentile. He found out that he wasnt accepted because 16 out of a 100 spotsRead MoreThe Stand For Affirmative Action1909 Words  | 8 Pagesamong everyone and also to give people of color equal opportunities. It allows university admissions officials or employers to take race, ethnicity, or gender into account when they make admission or hiring decisions. This solution is controversial because some people feel as though this policy gives African Americans an advantage and is thus in a way reverse racism. Critics also pose that allowing people into universities and jobs due to their race would see that they re unprepared for the work,Read MoreAut obiography Essay1967 Words  | 8 Pagescivil war in 1970, and assured my self that I must go beyond the confines of my continent – Africa to seek knowledge so as to assist in alleviating the suffering of my people. After I had graduated from high school, my dream of coming to the United States of America was far fetched reality. At that time in my life, coming to America was almost impossible. My family lost everything during the civil war. The civil war forced my parents to abandon their properties in the northern group of provincesRead MoreImpeachment of Andrew Johnson1606 Words  | 7 Pagesthis time the rift between Johnson and most Southern Democrats was too deep to heal. The break became final when Johnson allied himself with pro-union Whigs to fight the Secessionist Democrats in his state for several months. 2 When the Civil War began, Johnson was the only Senator from a Confederate state that did not leave Congress to return to the South. During the war, Johnson made the decision to join the Republicans in the National Union Party. In 1864, Johnsons big break came. Lincoln selected
Subscribe to:
Posts (Atom)